Home   »   CBSE Class 12 Biology Answer Key...

CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3

As per the date sheet, the Central Board of Secondary Education (CBSE) has administered the Class 12 biology exam today 19 March 2024. As per the student’s reviews, The Class 12 Biology paper was easy. most of the questions were straightforward. After completing the exam, students would rush to acquire CBSE Class 12 Biology Answer Key 2024 to double-check their answers. If you took the exam today, bookmark this page so you can acquire the biology answer key for all sets as soon as possible.

Class 12 Biology Answer Key 2024

The Class 12 Biology exam hold for 3 hours from 10:30 a.m. to 1:30 p.m. The Class 12 Biology exam will run for three hours, from 10:30 a.m. to 1:30 p.m. After the exam, students search the Internet for the CBSE Class 12 Biology Answer Key 2024. To address this issue, the Adda247 Experience faculty has provided you with an unofficial Class 12 Biology Answer Key for all sets, along with a full explanation. So, instead of browsing random websites, stay tuned to receive the Class 12 Biology answer key as soon as possible.

Ace your Preparation with CUET 2024 प्रतिज्ञा Science Complete Batch

Biology Answer Key 2024 Class 12 Paper Pattern

Biology is one of the core and vital subjects for those students who opt for the science streams. The pattern of the biology paper will be the same as the sample paper provided by the board. The paper consists of 33 questions which are divided into five sections. Out of all the sections, section A comprises MCQs and assertion-reason-based questions which is the most scoring portion. Let’s take a look at the class 12 biology paper pattern given in the table below.

Section Type of Question No of Questions Total Marks
A Multiple-Choice Questions (MCQs)/ Assertion-Reasoning 16 1 x 16 = 16
B Short Answer Questions 5 2 x 5 = 10
C Short Answer Questions 7 3 x 7 = 21
D Case-based/Source-based/Passage-based/Integrated Assessment Questions 2 4 x 2 = 8
E Long Answer Questions 3 5 x 3 = 15
TOTAL 70

Biology Class 12 Answer Key for All Sets

The CBSE Class 12 Biology is now over. Students are now looking for the CBSE Biology Class 12 Answer key for their respective sets. Our Adda247 Subject experts are now evaluating the questions and answers of today’s biology board paper. The Biology answer keys on this page will be updated for each question paper set and QP code. The answer will help students tally their marked replies for Section A’s multiple-choice questions 1-16, each worth 1 mark. Check out the Biology Section A Answer key of all sets given below.

Class 12 Biology Answer Key 2024 Set 2

Question Set 57/2/1-12

Question Number Correct Answers
1. An angiosperm embryo sac is located within the :
(A) Placenta
(B) Megasporangium
(C) Nucellus
(D) Ovary
(B) Megasporangium
2. CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_3.1 ((C) 1-(iii), 2-(iv), 3-(ⅰ), 4-(ii)
3. In humans, the secondary oocyte completes meiotic division when:

(A) it gets implanted in the uterine endometrium.
(B) it is released from the matured Graafian follicle.
(C) it is penetrated by the sperm cell.
(D) acrosomal enzymes break down the zona pellucida.

To be(D) acrosomal enzymes break down the zona pellucida. Updated
4. Which one of the following statements is not true?

(A) Flippers of whales and dolphins are homologous organs.
(B) Homologous organs have similar anatomical structure, but perform different functions.
(C) Homology indicates common ancestry.
(D) Homologous structures are a result of convergent evolution.

(D) Homologous structures are a result of convergent evolution.
5. A population is in genetic equilibrium/Hardy-Weinberg equilibrium for a gene with 2 alleles (dominant allele is ‘A’ and recessive allele ‘a’). If the frequency of allele ‘A’ is 0-6, then the frequency of genotype ‘Aa’ is:

(A) 0-21
(B) 0.42
(C) 0.48
(D) 0.32

(C) 0.48
6. In the double helical structure of DNA molecule, the strands are:
(A) identical and complementary
(B) identical and non-complementary
(C) anti-parallel and complementary
(D) anti-parallel and non-complementary
(C) anti-parallel and complementary
7. In a ‘transcription unit’, the ‘terminator’ is located towards the:
(A) 3′ end of the template strand
(B) 5′ end of the template strand
(C) 5′ end of the coding strand
(D) 3′ end of the coding strand
(D) 3′ end of the coding strand
8. A woman with normal vision has a colour blind father. She marries a man with normal vision. The percentage chance of their progeny being colour blind is:
(A) 25%
(C) 75%
(B) 50%
(D) 100%
(A) 25%
9. The vector for dengue fever is:
(A) Female Aedes mosquito
(B) Female Anopheles mosquito
(C) Male Aedes mosquito
(D) Female Culex mosquito
(A) Female Aedes mosquito
10.CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_4.1 (c)
11.Which one of the following is not a feature of plasmids?
(A) Circular
(B) Self-replicating
(C) Single stranded
(D) Extra-chromosomal
(C) Single stranded
12. The pyramid of biomass in sea is generally inverted because in sea:
(A) Biomass of fishes exceeds that of phytoplankton.
(B) Number of phytoplanktons is more.
C) Number of phytoplanktons is less.
(D)) Large fishes feed on small fishes
(A) Biomass of fishes exceeds that of phytoplankton.
Assertion-Reasoning Based Questions
13. Assertion (A): RNA is unstable and can mutate at a faster rate.
Reason (R): The presence of 2′ OH group in every nucleotide – makes it labile and easily degradable. of RNA
(a)
14. Assertion (A): Virus-infected cells produce interferons.
Reason (R): Interferons can cause inflammation of virus-infected cells.
(a)
15. Assertion (A): Specific enzymes are used to degrade the cell wall in organisms to isolate the DNA from the cell.
Reason (R): Fungal cell wall is degraded by the enzyme cellulase.
(c)
16. Assertion (A) Loss of biodiversity can occur due to overexploitation of ン resources.
Reason (R): Introduction of Clarias gariepinus in Indian rivers has led to a decline in native Indian fishes.
(D)

CUET PCB Mahapack

Class 12 Biology Set 1 Answer Key 2024

Question Set 57/5/1

Questions Correct Answers
1. A single gene that controls the expression of more than one trait is said t show
(A) Multiple allelism
(B) Polygenic inheritance
(C) Incomplete dominance
(D) Pleiotropism
(D) Pleiotropism
2. A person with trisomy of 21st chromosome shows
(i) Furrowed tongue
(ii) Characteristic palm crease
(iii) Rudimentary ovaries
(iv) Gynaecomastia
Select the correct option, from the choices given below:
(A) (ii) and (iv)
(B) (i), (ii) and (iv)
(C) (ii) and (iii)
(D) (i) and (ii)
(D) (i) and (ii)
3. Observe the schematic representation of assisted reproductive technology given below:
CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_6.1Identify the most appropriate technique depicted in the above diagram.
(A) IUT
(C) ICSI
(B) IUI
(D) ZIFT
(C) ICSI
4. Interferons are proteins secreted by
(A) RBC
(B) WBC
(C) Bacteria infected cell
(D) Virus infected cell
(D) Virus infected cell
5. During biological treatment of sewage, the masses of bacteria held together by fungal filaments to form mesh like structures are called
(A) primary sludge
(B) flocs
(C) activated sludge
(D) anaerobic sludge
(B) flocs
6. Which one of the following statements is correct in the context of observing DNA separation by agarose gel electrophoresis?
(A) DNA can be seen in visible light.
(B) DNA can be seen without staining in visible light.
(C) Ethidium bromide stained DNA can be seen in visible light
(D) Ethidium bromide stained DNA can be seen under UV light.
(D) Ethidium bromide stained DNA can be seen under UV light.
7. A phenomenon where a male insect mistakenly identified the patterns of a orchid flower as the female insect partner, and tries to copulate and thereby pollinates the flower is said to be:
(A) Pseudocopulation
(C) Pseudoparthenocarpy
(B) Pseudopollination
(D) Pseudofertilisation
(A) Pseudocopulation

Class 12 Biology Paper Analysis 2024

The biology paper is concluded at 01:30 P.M. We spoke with the students after the exam, and based on their initial reactions, they rated the paper as simple to moderate in difficulty. Despite being NCERT-based, the paper was slightly lengthy. The paper included some expected and forthright questions. In the table below, you can find a detailed analysis of the CBSE 12th Biology test 2024 by section.

CBSE 12th Biology Exam Analysis 2024
  • Overall difficulty level of the paper: Easy to Moderate to Tough
  • Difficulty level of Section A: Easy
  • Difficulty level of Section B: Easy to Moderate
  • Difficulty level of Section C: Moderate
  • Difficulty level of Section D: Moderate
  • Difficulty level of Section E: Moderate

CBSE Class 12 Biology Answer key 2024

In this video, Sonia Ma’am provides the complete analysis of the CBSE Class 12 Biology Question Paper. Watch the video Now.

CBSE Class 12 Biology Board Paper 2024 Set 1, 2, 3

Here we have provided the CBSE Class 12 Biology Question Paper PDF of all sets which will help students analyze the answer key. These papers also help students who are going to take the CBSE board exam in the upcoming academic session.

Sets Download Link
CBSE Class 12 Biology Question paper 2024 Set 1 Click Here
CBSE Class 12 Biology Board paper 2024 Set 2 Click Here
CBSE Class 12 Biology Paper 2024 Set 3 Click Here

CUET 2024 प्रतिज्ञा GT

CBSE Class 12 Biology Questions and Answers Last year

Q. Given below is Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Column A Column B
A GIFT
(i) Transfer of ovum from a donor into the fallopian tube of another female.
B ICSI
(ii) Transfer of semen from the donor into the vagina of the female.
C ZIFT
(iii) Injecting sperms directly into the ovum.
D IUI
(iv) Transfer of early embryos into the fallopian tube.

Choose the option where ART correctly matches with the procedure. 

a) (A)–(i), (B)–(ii), (C)–(iii), (D)–(iv)
b) (A)–(iv), (B)–(i), (C)–(ii), (D)–(iii)
c) (A)–(iv), (B)–(iii), (C)–(i), (D)–(ii)
(d) (A)–(i), (B)–(iii), (C)–(iv), (D)–(ii) 

Correct Answer- (d) (A)-(i), (B)-(iii), (C)-(iv), (D)-(ii)

Q. The decrease in the T-lymphocyte count in human blood will result in:

a) Decrease in antigens
b) Decrease in antibodies
c) Increase in antibodies
d) Increase in antigens 

Correct Answers- d) Increase in antigens

Q. At which stage evolution did humans use hides to protect their bodies and buried their dead?

a) Homo habilis
b) Neanderthal man
c) Java man
d) Homo erectus
Correct Answer- b) Neanderthal man

Q,The primary productivity in an ecosystem is expressed as:

a) gm-2 yr-1
b) K cal m-2
c) gm-2 yr
d) Kcal m-2 yr-1

Correct Answer- (b) K cal m-2

Q, A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of – 

(a) Commensalism
(b) Parasitism
(c) Amensalism
d) Mutualism 

Correct Answers- d) Mutualism 

Q, Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.

Q‘ AUCAGGUUUGUGAUGGUACGA 5‘ 

  1. a) Phenylalanine, Methionine
    b) Cysteine, Glycine
    c) Alanine, Proline
    d) Serine, Valine 

Correct Answers- c) Alanine, Proline 

Q. Select the pathogen mismatched with the symptoms of disease caused by it from the  list given below

(a) Entamoeba histolvtica : Constipation, abdominal pain.
(b) Epidermophyton: Dry scaly lesions on nail
(c) Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb
(d) Haemophilus influenzae : Blockage of the intestinal passage.
Correct Answer- (d) Haemophilus influenzae : Blockage of the intestinal passage.

Q. A human male decides to adopt a surgical method for contraception. Identify the point in the diagram where a cut would be made and tied.

CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_8.1(a) Point S
(b) Point R
(c) Point Q
(d) Point P
Answer: (c) Point Q
Q.Which of the following structures is well-developed in a mature seed of black pepper?
 (a) Perisperm (b) Thalamus (c) Sepals (d) Peduncle
Answer: (a) Perisperm 
Q. Observe the following line diagram depicting the 28 days menstrual cycle of a healthy young woman.
CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_9.1
Select the option of days on which this woman would be most and least fertile.
Most fertile days     Least fertile days

(a) 14-21                    1-7

(b) 10-17                   21-28

(c) 1-7                   14-21

(d) 21 28                   7-14

Answer: (b) Most fertile days: 10 – 17, Least fertile days: 21 – 28

Q. Which one of the following was not present during the Mesozoic Era of the geological time scale?
(a) Ferns
(b) Horsetails
(c) Ginkgos
(d) Bryophytes
Answer: (a) Ferns

Q. Identify the element used by Hershey and Chase to label the protein in their experiment, from the following options:

(a) p32
(b) S32
(c) S35
(d) p35
Answer: (c) S35

Q. DNA profiles of the child and three individuals 1, 2 and 3 who claim to be the parents of the child are given below. Select the option that shows the correct actual parent/parents of the child.

CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_10.1

(a) Individual 1 and 3
(b) Individual 1 and 2
(c) Individual 2 and 3
(d) Individual 1 is the only parent of the child amongst 1, 2 and 3
Answer: (b) Individual 1 and 2

Q. The given schematic illustration shows three steps ‘P’, ‘Q’ and ‘R’ of the polymerase chain reaction.

CBSE Class 12 Biology Answer Key 2024 Out for Set 1, 2, 3 -_11.1
Which of the following statements is correct with reference to the illustration given above?
(i) Step ‘P’ is showing denaturation at low temperature.
(ii) Step ‘Q’ is a denaturation of DNA strand at high temperature, followed by annealing.
(iii) Step ‘R’ is an extension of DNA in presence of thermostable DNA polymerase.
(iv) Step ‘Q’ is extension with two sets of primers.
(a) (i) and (iii) only
(b) (ii) and (iii) only
(c) (ii) only
(d) T (i) only
Answer: (c) (iii) only – Step ‘R’ is an extension of DNA in presence of thermostable DNA polymerase.
 

  1. Identify the fungus that ripens the famous ‘Roquefort’ cheese:

(a) Saccharomyces cerevisiae
(b) Propionibacterium sharmanii
(c) Monascus purpureus
(d) Penicillium notatum
Answer: To be Updated

  1. Select the options which is/are incorrect statement(s) with respect to T-lymphocytes in the human body.

(i) They are a type of white blood cells.
(ii) They are produced in bone marrow.
(iii) They remain active at all times in the body.
(iv) They mature in the bone marrow.
 
(a) (i) and (iv) only
(c) (iv) only
(b) (iii) only
(d) (iii) and (iv) only
Answer: (a) (i) and (iv) only

  1. Which one among the following regions is not a hotspot of biodiversity?

(a) The Indo-Burma Region
(b) Jaintia Hills in Meghalaya
(c) The Western Ghats and Sri Lanka
(d) The Himalayas
Answer: (b) Jaintia Hills in Meghalaya

Q. Human settlement often leads to habitat loss which leads to fragmentation, forming smaller patches of habitats. Select the statements that describe how a small patch differs from a large patch of the same habitat.

(i) Invasive species will never be seen here.
(ii) Population of large animals decreases.
(iii)Biodiversity decreases.
(iv) Competition from surrounding habitats increases.
 
(a) (ii), (iii) and (iv) only
(b) (ii) and (iv) only
(c) (i) and (iii) only
(d) (i), (ii) and (iii) only
Answer: (a) (ii), (iii), and (iv) only

Sharing is caring!

FAQs

Where can I get CBSE Class 12 Biology Answer Key 2024?

The CBSE Class 12 Biology Answer Key 2024 for all sets is shared on this page.

What is total marks of biology theory paper?

The total marks of the biology theory paper is 70 marks.

About the Author

Soumyadeep specializes in content creation for board exams, catering to the demands of CBSE, ICSE, and other state boards students. He has two years of experience in the education industry. He has a graduate degree in Zoology Honours, he delivers content across several domains, including CUET (UG and PG), NEET, JEE, and universities. 

TOPICS: