Home   »   NEET 2025   »   NEET 2024 Question Paper

NEET 2024 Question Paper, PDF Download by NTA

The National Testing Agency publishes the NEET Question Paper 2024 PDF at the official website of NTA at https://exams.nta.ac.in/NEET/. Students can understand the NEET questions’ difficulty level and important areas of the NEET syllabus by analyzing the NEET 2024 Question PaperThe NTA has published the NEET question paper 2024 for both the regular exams and re-exams held by the authority. Download NEET 2024 papers here for free.

NEET 2024 Question Paper

NEET UG 2024 exam was conducted on May 5 while the NEET Re-Exam was held on June 23, 2024. The National eligibility cum entrance exam was held in a single shift from 2 pm. Students are given 3 hours 20  minutes to solve the NEET Question Paper 2024. The NEET 2024 Question Paper comprises questions from 4 subjects – Zoology, Botany, Physics and Chemistry. 50 questions were asked from each subject. In each subject, there are 2 sections, Section A consists of 35 questions and section B consists of 15 questions out of which 10 must be attempted.

NEET 2024 Paper: Highlights

Know the details of the NEET 2024 exam high light in the table below.

Particulars

Details

Mode of the examination

Offline

Duration of the examination

Three hours and Twenty Minutes (3.20 hours)

Exam timing

2 pm to 5.20 pm

Type of questions

Multiple Choice Questions (MCQs)

Total number of Questions

200 (180 applicable questions for attempt)

Total Marks

720

Negative marking

Yes

Marking Scheme

+4 for each correct answer

-1 for each incorrect answer

0 for un-attempted or extra attempted question

Total sections in the question paper

3 (Two sections for each subject)

Section A – 35 questions

Section B- 15 questions (10 to be attempted)

NEET Subjects

Physics, Chemistry and Biology (Botany + Zoology)

NEET

NEET Question Paper 2024: Question and Answers

Some of the questions present in the NEET question paper 2024 from all sections are being provided here to help candidates understand the nature of questions and the difficulty pattern. All the questions of the NEET UG 2024 exam has been provided in the official PDF available below in the article.

Physics

Q) If the monochromatic source in Young’s double slit experiment is replaced by white light, then

1. There will be a central dark fringe surrounded by few coloured fringes.
2. They will be a central bright white fringe surrounded by a few coloured fringes.
3. All bright fringes will be of equal width.
4. Interference pattern will disappear.

Q) An unpolarised light beam strikes a glass surface at Brewster’s angle. Then

1. The refracted light will be completely polarised.
2. Both the reflected and refracted light will be completely polarised.
3. The reflected light will be completely polarised but the refracted light will be partially polarised.
4. The reflected light will be partially polarised.

Q) A tightly wound 100 turns coil of radius 10 cm carries a current of 7A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4π ×10^−7 SI units):

1. 4.4 T
2. 4.4 mT
3. 44 T
4. 44 mT

Q) A particle moving with uniform speed in a circular path maintains:

1. Constant acceleration.
2. Constant velocity but varying acceleration.
3. Varying velocity and varying acceleration.
4. Constant velocity.

Q) A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 Nm^−1, then the excess force required to take it away from the surface is:

1. 198 N
2. 1.98 mN
3. 99 N
4. 19.8 mN

Chemistry

Q) For the reaction 2A ⇌ B + C, KC = 4 × 10^−3. At a given time, the composition of reaction mixture is : [A] = [B] = [C] = 2 × 10^−3 M.
Then, which of the following is correct?

1. Reaction has a tendency to go in forward direction
2. Reaction has a tendency to go in backward direction
3. Reaction has gone to completion in forward direction
4. Reaction is at equilibrium

Q) ‘Spin only’ magnetic moment is same for which of the following ions?
A. Ti3+

B. Cr2+

C. Mn2+

D. Fe2+

E. Sc3+
Choose the most appropriate answer from the options given below:

1. A and E only
2. B and C only
3. A and D only
4. B and D only

Q) Which reaction is NOT a redox reaction?

1. 2KClO3 + I2 → 2KIO3 + Cl2
2. H2 + Cl2 → 2HCl
3. BaCl2 + Na2SO4 → BaSO4 + 2NaCl
4. Zn + CuSO4 → ZnSO4 + Cu

Q) The highest number of helium atoms is in

1. 4 u of helium
2. 4 g of helium
3. 2.271098 L of helium at STP
4. 4 mol of helium

Q) Given below are two statements:
Statements I: Aniline does not undergo Friedel-Crafts alkylation reaction.
Statement II: Aniline cannot be prepared through Gabriel synthesis.
In the light of the above statements, chose the correct answer from the options given below:

1. Both Statement I and Statement II are false.
2. Statement I is correct but Statement II is false.
3. Statement I is incorrect but Statement II is true.
4. Both Statement I and Statement II are true.

Online Crash Course for NEET 2025

Biology

Q) Identify the set of correct statements:
A. The flowers of Vallisneria are colourful and produce nectar
B. The flowers of waterlily are not pollinated by water
C. In most of water-pollinated species, the pollen grains are protected from wetting.
D. Pollen grains of some hydrophytes are long and ribbon like
E. In some hydrophytes, the pollen grains are carried passively inside water.
Choose the correct answer from the options given below:

1. A, B, C and D only
2. A, C, D and E only
3. B, C, D and E only
4. C, D and E only

Q) These are regarded as major causes of biodiversity loss:
A. Over exploitation
B. Co-Extinction
C. Mutation
D. Habitat loss and fragmentation
E. Migration

Choose the correct option:

1. A, B, C and D only
2. A, B and E only
3. A, B and D only
4. A, C and D only

Q) The lactose present in the growth medium of bacteria is transported to cell by the action of:

1. Acetylase
2. Permease
3. Polymerase
4. Beta-galactosidase

Q) How may molecules of ATP and NADPH are required for every molecule of CO2 fixed in the Calvin cycle?

1. 2 molecules of ATP and 2 molecules of NADPH
2. 3 molecules of ATP and 3 molecules of NADPH
3. 3molecules of ATP and 2 molecules of NADPH
4. 2 molecules of ATP and 3 molecules of NADPH

Q) Which of the following is an example of actinomorphic flower?

1. Cassia
2. Pisum
3. Sesbania
4. Datura

Q) Which of the following is not a natural/traditional contraceptive method?

1. Periodic abstinence
2. Lactational amenorrhea
3. Vaults
4. Coitus interruptus

Q) Which of the following statements is incorrect?

1. Most commonly used bio-reactors are of stirring type.
2. Bio-reactors are used to produce small scale bacterial cultures.
3. Bio-reactors have an agitator system an oxygen delivery system and foam control system.
4. A bio-reactor provides optimal growth conditions for achieving the desired product

Q) In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:

1. 10th segment
2. 8th and 9th segment
3. 11th segment
4. 5th segment

Q) The flippers of the Penguins and Dolphins are the example of the

1. Natural selection
2. Convergent evolution
3. Divergent evolution
4. Adaptive radiation

Q) Following are the stages of cell division :
A. Gap 2 phase
B. Cytokinesis
C. Synthesis phase
D. Karyokinesis
E. Gap 1 phase
Choose the correct sequence of stages from the options given below :

1. E-B-D-A-C
2. B-D-E-A-C
3. E-C-A-D-B
4. C-E-D-A-B

NEET 2025

NEET Question Paper 2024 Difficulty Level

The NEET Question paper 2024 was of moderate level. In each subject, the maximum mark in section A is 140 and a student can score a maximum of 40 marks in section B. Let’s review how was the NEET Question Paper 2024 PDF.

Subject Difficulty Level Most Questions were asked from- Chapters Overall Paper Level
Zoology Easiest section Human Health and Diseases, Human Reproduction, Plant Physiology, Cockroaches Easy to Moderate
Botany Easy Plant Cell, Animal cell, photo synthesis
Physics Toughest Section Mostly numerical-based questions were asked
Chemistry Moderate Organic-18, Physical -16, Inorganic-16 Questions

Get RE NEET Question Paper 2024 PDF Download

NEET 2024 Question Paper PDF Download Link

We will soon publish the NEET 2024 Question Paper PDF Download links here in this section. NEET paper PDFs are significant for aspiring students who will take the NEET UG entrance exam next year. Practicing these questions PDF with solutions will help them to know the NEET Exam Pattern and difficulty level very well. Get the NEET Question Paper PDF Download 2024 from the links below.

NEET Question Paper 2024 PDF Download Link All Sets (Available Soon)
NEET 2024 Question Paper PDF Paper Code T1 (Exact paper)NEET 2024 Question Paper, PDF Download by NTA_6.1
NEET Question Paper Download 2024 Paper Code R3 (Exact Paper)NEET 2024 Question Paper, PDF Download by NTA_6.1

NEET 2024 Question Paper with Answers

NEET UG  2024 question paper with Answers is complete based on the NEET updated syllabus. The NEET syllabus has undergone many changes this year.  So this year’s NEET 2024 Question paper is a blueprint to guide all the future NEET aspirants.

NEET 2024 Paper with Answers

  • Which of the following is an example of an actinomorphic flower?
    (1) Cassia
    (2) Pisum
    (3) Sesbania
    4 Datura

Answer – 4) Datura.

  • What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism?
    A. The piece of DNA would be able to multiply itself independently in the progeny cells of the organism.
    B. It may get integrated into the genome of the recipient and be inherited along with C. It may multiply and the host DNA.
    D. The alien piece of DNA is not an integral part of the chromosome.
    E. It shows the ability to replicate.
    Choose the correct answer from the options given below:
    (1) D and E only
    (2) B and C only
    (3) A and E only
    (4) A and B only

Answer – (2) B and C only

  • Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
    1)6 bp
    (3) 10 bp
    (2) 4 bp
    (4) 8 bp

Answer – 6 bp

  • The cofactor of the enzyme carboxypeptidase is:
    (1) Niacin
    (2) Flavin
    (3) Haem
    4)Zinc (ANSWER)
  • Which of the following are required for the dark reaction of photosynthesis?
    A. Light
    B. Chlorophyll
    C. CO₂
    D. 60753
    D. ATP
    E. NADPH
    Choose the correct answer from the options given below:
    (1) B, C and D only
    (2) C, D and E only (ANSWER)
    (3) Dand E only
    (4) A, B and Confy
  • NEET 2024 Question Paper, PDF Download by NTA_8.1
  • NEET 2024 Question Paper, PDF Download by NTA_9.1
  • During the preparation of Mohr’s salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of Fe2+ ion?

(1) concentrated sulphuric acid
(2) dilute nitric acid
(3) dilute sulphuric acid (ANSWER)
(4) dilute hydrochloric acid

  • The plot of osmotic pressure (1) vs concentration (mol L-1) for a solution gives a straight line with a slope of 25.73 L, bar mol. The temperature at which the osmotic pressure measurement is done is: (Use R 0.083 L bar mol K

(1) 310°C
(3) 12.05°C
(2) 25.73°C
4)37°C (ANSWER)

  • Identify the correct answer.
    (1) BF; has non-zero dipole moment
    (2) The dipole moment of NF, is greater than that of NH3 X
    (3) Three canonical forms can be drawn for co-ion.
    (4) Three resonance structures can be drawn for ozone
  • A transcription unit in DNA is defined primarily by the three regions in DNA and these are concerning upstream and downstream end;
    (1) Structural gene, Transposons, Operator gene
    (2) Inducer, Repressor, Structural gene
    (3) Promotor, Structural gene, Terminator (ANSWER)
    (4) Repressor, Operator gene, Structural gene
  • Identify the set of correct statements:
    A. The flowers of Vallisneria are colorful and produce nectar. R
    B. The flowers of waterlily are not pollinated by water,
    C. In most of water-pollinated species, the pollen grains are protected from wetting. ✓
    D. Pollen grains of some hydrophytes are long and ribbon-like.
    E. In some hydrophytes, the pollen grains are carried passively inside water.
    Choose the correct answer from the options given below:
    (1) A, B, C and D only
    (2) A, C, D and E only
    (3)B, C, D and E only (ANSWER)
    (4) C, D and E only
  • Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
    1)Phospholipids (ANSWER)
    (2) Glycerides
    (3) Carbohydrates
    (4) Amino acids
  • These are regarded as major causes of biodiversity loss:
    A. Over exploitation
    B. Co-extinction
    C. Mutation
    D. Habitat loss and fragmentations
    E. Migration
    Choose the correct option:
    (1) A. B. C and D only
    (2) A, B and E only
    (3) A. B and D only(ANSWER)
    (4) A. C and D only
  • NEET 2024 Question Paper, PDF Download by NTA_10.1
  • NEET 2024 Question Paper, PDF Download by NTA_11.1
  • Given below are two statements:
    Statement 1: In the nephron, the descending limb of loop of Henleris impermeable to water and permeable to elettfolytes.
    Statement II: The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption.
    In the light of the above statements, choose the correct answer from the options given below:
    (1) Both Statement I and Statement II are false (ANSWER)
    (2) Statement is true but Statement II is false 7
    (3) Statement 15 false but Statement II is true
    (4) Both Statement I and Statement II are true
  • Given below are two statements: one is labeled as Assertion A and the other is labeled as Reason R:
    Assertion A: Breast-feeding during initial period of infant growth is recommended by doctors for bringing a healthy baby.
    Reason R: Colostrum contains several antibodies absolutely essential to develop resistance for the new born baby.
    In the light of the above statements, choose the most appropriate answer from the options given below:
    (1) Both A and R are correct but R is NOT the correct explanation of A.
    (2) A is correct but R is not correct.
    (3) A is not correct nol correct but R is correct.
    (4) Both A and are correct and R is the correet 10 explanation of A. (ANSWER)
  • Following are the stages of pathway for conduction of an action potential through the heart:
    A. AV bundle
    B. Purkinje fibres
    C. AV nodem
    D. Bundle bratches
    E. SA node
    Choose the correct sequence of pathway from the options given below:
    (1) A-E-C-B-D
    (2) B-D-E-C-A
    (3) E-A-D-B-C

(4) E-C-A-D-B (ANSWER)

  • Which one is the correct product of DNA-dependent RNA polymerase to the given
    template? 5 AUGUAL GUA 3’TACATOGCAMATATOCATICAS
    (1) 5’AUGUAAAQUUUAUAGGUAAGU3K
    (2) S’AUGUACCGUUUAUAGGGA AGU3
    (3) 5’ATGTACCGTTTATAGGTAAGT3’X
    (4) S’AUGUACCGUUUAUAGGUA AGUS (ANSWER)
  • The “Ti plasmid of Agrobacterium tumefaciens stands for
    (1) Tumor independent plasmid
    (2) Tumor-inducing plasmid (ANSWER)
    (3) Temperature independent plasmid
    (4) Tumour inhibiting plasmid
  • Which of the following is not a natural/traditio contraceptive method?
    (1) Periodic abstinence
    (2) Lactational amenorrhea
    (3)Vaults (ANSWER)
    (4) Coitus interruptás
  • The DNA present in the chloroplast is:
    1)Circular, double Stranded (ANSWER)
    (2) Linear, single stranded
    (3) Circular, single stranded
    (4) Linear, double stranded
  • NEET 2024 Question Paper, PDF Download by NTA_12.1

NEET 2024 Question Paper, PDF Download by NTA_13.1

NEET 2024 Question Paper, PDF Download by NTA_14.1

 

NEET Paper Timing

The NEET 2024 has conducted on May 5, 2024, from 2 PM to 5.20 PM, NEET Question Paper is provided in 13 languages. A total of 200 questions are asked but students need to attempt only 180 questions. No extra marks will be given for extra attempts. Students can score a maximum of 720 marks. They have to choose correct answers on the NEET OMR sheets. If any option is chosen by mistake, that will not be modified anymore. So it crucial to be very attentive during our filling process.

NEET Last Year Question Paper Structure

Here let’s check out the NEET question paper pattern, how much questions were asked from all the sections.

 NEET Question Paper
Subjects Section No of Questions Marks
Botany
Section A 35 140
Section B 15 40
Zoology
Section A 35 140
Section B 15 40
Physics
Section A 35 140
Section B 15 40
Chemistry
Section A 35 140
Section B 15 40
720

NEET Question Paper 2023 with Solution

Every year, around 15 lakh candidates take the test, and about 1 lakh of them pass. We advise you to start by answering these NEET PYQs if you are starting your NEET 2025 preparation this month. The table below also contains the NEET 2023 question paper. This website offers the other NEET exam question papers along with answers.

PDF Link
NEET 2023 Question Paper PDF with Solutions

NEET 2024 Paper PDF Based Solutions for All Codes

Practicing the neet 2024 question paper pdf enables proper time management skills for students. As the NEET UG exam is administered in an OMR sheet in offline modes, it is very effective if students practice the neet 2024 question paper pdf with time. In this arrangement, they will get the feel of a real exam environment.

Advantage of Solving NEET 2024 Paper

Solving the NEET 2024 paper can be highly advantageous for NEET 2025 aspirants. Here are the key benefits:

Familiarity with Exam Pattern
Insight into Question Types: The 2024 paper helps you understand the type of questions asked and how they are framed, giving you an idea of what to expect in 2025.
Weightage of Topics: You can observe which topics were given more importance, helping you prioritize your study accordingly.
Understanding Difficulty Levels
By solving the NEET 2024 paper, you get a clear understanding of the difficulty level of the exam. You can assess how challenging questions are in various sections (Physics, Chemistry, Biology).
Improved Time Management
Practice Under Timed Conditions: Solving previous papers under exam conditions enhances your ability to manage time effectively during the actual exam.
Speed and Accuracy: It helps in building speed while maintaining accuracy, which is crucial to scoring well in NEET.
Self-Evaluation
Identifying Strengths and Weaknesses: By comparing your performance with the actual answer key, you can identify areas where you’re strong and those that need improvement.
Benchmarking: It helps you benchmark your preparation level with the actual standard of NEET.
Boosts Confidence
As you solve the paper and familiarize yourself with the exam environment, it increases your confidence, reducing anxiety and exam-day pressure.
Application of Concepts
Solving past papers forces you to apply concepts rather than relying on rote memorization, ensuring you grasp the material in-depth.
7. Adapting to Changes
Awareness of New Trends: If there are any changes or new trends in the 2024 NEET paper (like the introduction of new question formats), you’ll be better prepared to tackle them in 2025.
By analyzing and practicing the NEET 2024 paper, you can optimize your preparation strategy for NEET 2025, making your study more efficient and focused.

All NEET UG Related Articles
NEET 2025 Exam Date
NEET Exam Pattern
NEET Age Limit
NEET Online Coaching
NEET Question paper

 

Sharing is caring!

FAQs

How was the 2024 NEET question paper?

This year paper was easy to moderate. The Biology section was the easiest in the question paper for NEET 2024. The Botany section was tougher than that of the Zoology section. On the other hand, the Zoology section was mostly asked from the Class 12 syllabus.

Is NEET 2024 Paper is leaked?

The Supreme Court on July 8 observed that there is no doubt that the controversy-ridden medical entrance exam NEET-UG 2024 held on May 5 was compromised due to a paper leak.

Can I crack NEET in 1 month? After practice this paper

Sure, you can pass the NEET exam in 30 days. Effective preparation strategy with a focus on concepts and the use of NCERT books along with practice and consistent revision can help you succeed in the NEET exam.

How many students scored 720 in NEET 2024?

Earlier, 67 students scored 720 out of 720 in the NEET 2024 exam. Among these, 6 candidates achieved 720 marks due to grace marks. after the re exam the number reduced to 61.

Has anyone got 719 marks in NEET?

Two candidates have scored 718 and 719 out of 720 in NEET 2024, which is impossible as per the marking scheme.

What went wrong in NEET 2024 Question paper?

NEET-UG faced allegations of question paper leaks.

About the Author
Monisa
Monisa
Author

Hi buds, I am Monisa, a postgraduate in Human Physiology (specialization in Ergonomics and Occupational health) with 2 years of experience in the school education sector. With versatile writing skills, I provide educational content to help students find the right path to success in various domains, such as JEE, NEET, CUET, CLAT, other entrance and Board exams.